! Yeah! Yeah! You got that vibe Makes them come alive You so picture perfect Yeah! Yeah! You walk that park Watch that monster cry You so picture perfect Yeah! Yeah! Yeah! Yeah! Girl, you're feeling so bad Everybody wants to feel like a fan So I'm a dick Just keep going with it Yeah! Yeah! You got that vibe Makes them come alive You so picture perfect Pushingagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagt Everybody wants to feel like a bad or a bad Just keep going with it Don't go away, it's so bad Everybody wants to feel like a bad or a bad Just keep going with it Yeah, you got that vibe, it's a fun life It's a picture perfect You got that vibe, it's a monster vibe It's a picture perfect Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Ooh Uh, yo to the yo to the ho ho hoes, and boy to the hoes do we have some news. Take it away, Mr. Pants, if I can pull up the right thing here. Speaking of hoes, go ahead, Pants. Good evening, everyone. Just in from the Superior Court of the State of California for the County of Los Angeles. A judgment in the case of Jose DeCastro versus Catherine Peter, Daniel Clement, Michael Perattini, David Omoe Jr., and John Doe's 1 to 30 inclusive. On April 15, 2025, plaintiff Jose DeCastro filed a voluntary request for dismissal, without prejudice, of defendant Michael Perattini, eight days before the hearing on defendant Michael Perattini's motion for terminating sanctions, which was originally scheduled for April 23. On April 23, the Court continued defendant Michael Perattini's motion for terminating sanctions until May 29, which was the same day as the hearing on defendant Michael Perattini's motion for summary judgment. On May 1, defendant Michael Perattini filed a motion to vacate the dismissal, without prejudice, of defendant Michael Perattini, to be heard concurrently with the continued motion for terminating sanctions on May 29. On May 29, defendant Michael Perattini's motion to vacate or strike plaintiff Jose DeCastro's voluntary request for dismissal of the complaint, without prejudice, the motion for terminating sanctions, and the motion for summary judgment, all came on regularly for a hearing in the above entitled court on May 29. R. Paul Keternick appeared on behalf of defendant Michael Perattini. Claintiff appeared in proper. The court took the matter under submission. On July 3, having taken the matter under submission, the court ordered as follows. 1. Defendant Michael Perattini's motion to vacate or strike plaintiff Jose DeCastro's voluntary dismissal without prejudice is granted. The court orders the dismissal of the case without prejudice entered on April 17. On plaintiff's voluntary request for dismissal is vacated, as to defendant Michael Perattini only. 2. Defendant Michael Perattini's motion for terminating sanctions is granted. The court orders plaintiff's complaint against Perattini dismissed in its entirety with prejudice. Further, the court orders plaintiff to pay defendant Perattini additional monetary sanctions under CCP Section 2023.030 in the amount of $4,560. Ten hours at $4.50 an hour plus a $60 filing fee. 3. Defendant Michael Perattini's motion for summary judgment on plaintiff's remaining cause of action for right of publicity torts is denied as moot. Additionally, the court has ordered sanctions in the past in favor of defendant Michael Perattini as follows. On March 7, 2024, the court ordered sanctions in the amount of $1,635 payable by plaintiff Jose DeCastro to defendant Michael Perattini. On defendant Michael Perattini's motion to compel responses to form interrogatories. On May 16, 2024, the court ordered sanctions in the amount of $4,500 payable by plaintiff Jose DeCastro to defendant Michael Perattini on plaintiff Jose DeCastro's motion to compel the production of documents set number two. On July 30, 2024, the court ordered sanctions in the amount of $4,560 payable by plaintiff Jose DeCastro to defendant Michael Perattini on defendant Michael Perattini's motion to compel the deposition of plaintiff Jose DeCastro. Now, therefore, it is ordered, adjudged, and decreed that plaintiff Jose DeCastro's voluntary request for dismissal without prejudice of defendant Michael Perattini filed on April 15, 2025 is hereby vacated as to defendant Michael Perattini only. Clagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagt as ordered by the Honorable H.J. Ford III, Judge of the Superior Court. Thank you. Yance, could you also read the minute notes? Because there is something in there. Well, that would require me... You don't have them on the screen. That would require... Oh, okay. I still have to find them. Now they've found them. The nature of proceedings. Yes. That's very short. Order to show cause regarding entry of judgment pursuant to the motion for terminating sanctions on July 3, 25. The matter is called for hearing. The court reviews, signs, and grants the judgment submitted. See the judgment from September 17 for details. Defendant is to give notice. Go up above that to appearances. Appearances. Da-da-da-da-da-da. Oh. Appearances. Yes. For plaintiff, Jose DiCastro, telephonic, appeared later? He was late for his own court hearing. And for defendants, Raymond Paul Katranek in court. He showed up in person. Yeah. DiCastro didn't even show up on time. Apparently, he found out later. Governor. Governor. Governor. Governor of material. Yep. First, yes. Thank you, everyone, for joining us today. Thank you, Mr. Pants, for that excellent reading, as we've seen. Now, there is no further updates as to Kate Peter. Remember, last year, or last, when this came down, immediately after this verdict, they tried to have a hearing on the judgment, and Kate didn't show for that hearing because Kate was never notified of that hearing because Kate has never been officially notified of anything in this case, basically. Minor details. Trifling. Trifling. Minor details. So, they had her show up. They were trying to have her show up for the hearing, and she was never told the hearing, and, in fact, it's in the court record. If you go back to the court record, they didn't even send her a notice. So, it's unclear where they're going to go. There is a default, but not a default judgment. It just means that Chili got the court clerk to say she's in default. Doesn't mean much unless the hearing is held and the judge determines that she actually defaulted and it becomes a default judgment. Now, that would mean that Chili would have to put on a case and show that Kate was guilty of everything that he is saying from the conspiracy to stealing his car to everything. And I don't see that happening. Don't forget the Nutella. I was just going to say that. I was just going to say that. Yes. Yes. So, the Nutella, because it's been, what, three years since that incident, that incident occurred somewhere around this time three years ago because, remember, he got the big jar of Nutella for his birthday on the 11th. Oh, no. Because, remember, he was making such a big deal about it and then all of a sudden there was Nutella on his door and a bag of dog poop or something. So, I don't know. So, this is apparently over and we're trying to get Blue Bacon on one of these days to talk about what he can talk about. But Chili's in the hole $15,000 and it explains why he was so somber today at the end of his live stream which only averaged 92 concurrent viewers and that's nothing because we're doing 24. Don't say it's over. Was it over when the Germans bombed Pearl Harbor? And it's not over now. That's right, Bruno. Basically, he was on and at the end of the live stream he was like, I don't have the money to print the hats now so you guys gotta buy my $50 hoodies so I can pay for the hats. Okay. Hey, Rose. Good to have you here, hon. And she Rose dyed her hair red. So, I'm happy. Ooh. Me too. About time. Thank you, Dave, for the $5 super chat if this ever scrolls to it. Uh, so he has to prove the same stuff against Kate that he couldn't prove against BB. Yes. He basically has to prove this entire case to get the damages he wants from Kate. Yep. Or to get the defaults. He's brilliant. Yeah. And that's just not going to happen. In the game? The game? Well, he needs $100,000 for the game, but, you know, $15,000 in the hole to, to, uh, to Blue Bacon, you know. Uh-huh. And, there's a lot of ways that they can go after him because it's the same ways that, you know, uh, they're talking about going after, like, Frauditor Troll if he were to lose the lawsuit or, uh, Irish Demon if he were to lose that lawsuit. So, there are certain tactics that, you know, his side is using that Blue Bacon could be using as well. It's, Yeah, it makes me wonder, can you garnish Super Chats? And the, and the insurance company is coming after him for $100,000. Ooh, who's coming after him? Bacon's insurance company. Yep. Uh, that's not what I heard, but where did Bacon say that? He said it a long time ago. Okay. He, he filed a claim with his, um, personal liability. Right. They fired him on it and he won. Well, let's, let's make sure that's an accurate number before we go reporting it, but, Okay. The, the number might not be accurate. He said, he've said it's more than that. Right. Like, the insurance company is subrogating against Chile for their cost. Right. You know, I, I subrogate my traffic tickets, you know. Uh-huh. No, you, you charge them to me. You say, this is, this is my real job. And, yeah, you ignore your real job. You say, this is a real job. But, yes, uh, wages from YouTube can be garnished. Uh, they're wages. And, any amount, like, right now, we don't make hardly any money off the videos or the live streams. We make our money off of super chats. Uh, Dave does a great job every month of helping support us. Uh, plus everybody else who, who, who, who sends in a super chat. The vast majority of any money we make off the channel is memberships and super chats. And, that is money that should someone get a default against me can be tapped into to, to pay back things because it is revenue. Oh, whoa, whoa, whoa, whoa, whoa, whoa, whoa. I got a new goal. I got a new goal. 10 super chats of any denomination. I'm going after Jim. Okay. Uh, for what? Yes, yes. Like, like romantically? Pain and suffering. No, I'm going, I'm, I'm suing him for wages. Yep. Oh, yeah. Yeah, I mean, back pay. Yep. Don't forget emotional distress and, yes, the wage. The whining. Yes. The whining. Yes. Yes. The turning over the show to me and then rudely taking it back. Yep. Yep. And just remember. I'm going to have died and now you're still here. Yep. Yep. Yeah. Yeah. Yep. Hold on. We got another 20 bucks from Mr. Pants. Yes. Oh, wait. So you're saying these things actually work. Score. Yes. Yes. Yes. Out of the, out of the 20 bucks will take about 15 bucks after YouTube. It, it, Chili's not lying. They take a huge cut, but yeah, we, we make 50%. No, they make also, it also feeds the algorithm though. Yes. It also feeds any interaction is good interaction. Hold on. That's one. That's one. But yeah, let's do, let's do, I'm counting Dave's. At the end of, at our, on the 20th, between the 20th and the 22nd, like this year, it's the 23rd, I think, or this, this week, this month, I am still sedated. So next week, I'll get last month's revenue for August. And this week, because we haven't been on the air with me, uh, pushing super chats, we're kind of, uh, let alone, plus we haven't been doing as well because all of YouTube is not doing as well with the videos. Uh, it, it's going to be a lean month next month. It looks like just because everyone is in the shithole. So are you impugning Pope Phil's fundraising abilities? Yeah. Yes. Yes. He does that all the time. He does that all the time. No, no, I, look, I, I, I have to defend Jim on this because it's affecting everybody with their new algorithm. You don't have to, you don't have to, you son of a bitch. Hold on a second. Uh, thank you, Parson, member for 13 months, level Pope's blessings, which means he can be, he can be married off to NCR. Uh, I should be paid for every time I get married. This is true. So, uh, Mr. Pope Phil, for pain and suffering at least. Uh, dearly beloved. Hey, no, no, we're not marrying me off. We're marrying Parson off to pants. Oh, to me. Oh, we are marrying Parson in pants. Daryl and Robin were gathered here for this very special occasion. Come on, we have two of our favorite people who want to marry you together. And I defended you. I'm not going to drop all. That is against God's law. Yeah, we've done that before. And? Yeah, so? Your point is? Uh, hell, hell is beckoning us. Where was it? Where was it? Oh, yes. Oh, yes. Pants, do you take Parson to be a lawfully wedded? You two, partner and spouse? Oh, I do. I do. I do. I do. I do. I do. And we're all going to hell. You're getting pants as your lawfully YouTube spouse, whether you like it or not. So, any reply is a reply of consent. God damn this show. I hate it. By the power of us, it's me. I kill each jacksock. I now pronounce you two YouTube spouses until midnight. You may not pick us each other. I always cry at pants as weddings. Mwah. Mwah. Mwah. Somebody got a hanky. Now, speaking of weddings, we are on the air all day on Saturday from 8 a.m. Eastern until 9 p.m. Eastern, meaning that we'll have a marathon for 12 hours, then the last hour will be our normal hangout. And Gia will be sending us food via DoorDash or whatever all day, so you can see me try to eat things. Hey, I did good last time. Yes, you did. Yes, you did. And during the day, now, I won't be putting my body on webcam, but I'll have to do exercise bike for 30 minutes when Mr. Phil will be hosting the show. And you can hear me drop dead in the background. What? Well, you want to be on the air when I drop dead. I have to do exercise bike on Saturday during the 12 hours. Oh, it's Saturday. Yeah. Okay. Yes, Saturday. Saturday is fine. Yes. Yes. So, and you may actually get to nude cook again. I don't care. We need to fill 13 hours. Please. I'd fund that. I need it. I need it. I need it. I need my skateboard and I need my nude barbecuing. Good Lord. So, yeah, I caught that one. Uh, why did you go to a black screen? Mr. NCR, are you with us? I'm here. I don't know what happened. The black screen of death. Yes. You're black screening it, but you're back. Your icon is back. It's back. It is back. So ladies and gentlemen, that is Saturday. It's a celebration of both Chili's birthday. and my birthday, which is the end of the month, September 30th. Uh, yes. I'll be a stunning new age. Yes. A stunning new age. A cunning new age. A cunning new age. And, yes, unfortunately, oh, that also means that Bill gets to do his happy birthday song on the 30th. Yes. Yes. On the 30th. Yes. Yes. Oh, boy. We're all so happy about that. Uh, let's see. Cancel here. Let's go. Where is drunk girl? We've got a very, remember to stock up on. My darling. Let me. Yes. I'll try and visit daily when you guys are in BC. Okay. Thanks. And if anyone wants to buy me anything for my birthday, we have the cat wish list and we also have my own wish list that I can distribute. That's, uh, and we also have newspaper stuff because, yeah, that hard drive still needs replacing, unfortunately. Put the, uh, put the vapor tabs in there, Jim. I'll stick them on the list. Yeah. Put them on the list. They're good to have as a go-to if you're congested. Um, Artie, Artie, uh, Artie's corporate fiction was sick this week. I suggested them. He said, right. Amazing. Yeah. He said it was amazing. What a difference it made. What, what brand are these things? Well, there's a bunch of them. It depends on, you know, what you're looking, eucalyptus mint or whatever. People, you know, scents are very personal, but there's a bunch of them on Amazon. But they're called vapor tabs? Yeah, they're like a tab you put in the flower, uh, the shower floor. And the steam, it creates a vapor when you're showering that clears your sinuses. And I've heard great things about them. I'm just trying to help. I'm a giver. I'm a giver. He's a giver. I'm a giver. Yes, she is. Yes, she is. She is a giver. I'm going to have to order some of those. I'm going to have to put up vapor tabs on Amazon. There's tons of varieties. Also, if you have suggestions for things to show, mainly drunk girls and, uh, webcam, or police cam videos, please put them over on the suggestions area on our discord server. Or we do have to fill 12 hours. You better clean that up because some of the Vestal Virgins have webcams that they may suggest that you show. Yeah, that's not going to happen. Uh, but we are going to a very, very, very special edition of drunk girl tonight because she is not quite at the record, but let's see what she has in store for us as we go to 19 year old woman gets drunk and crashes her car after learning boyfriend cheated. NCR, are you cheated on her? No. It is Amelia, Ohio. That's nowhere near me. See? Nowhere near me. See? It's in Ohio. It's near you. November 7th, 2024. That could be anybody's ass. You were gone that day too. Yeah, you weren't on the air with us that day. Yeah. Yeah. Yeah, because I was in the hospital. You were breaking this girl's heart. You're breaking this girl's heart. No, that was one of the days I was in the hospital. excuses. It's always excuses. It is. It is. It is. No, no, I know for a fact that was one of the days I was in the hospital when my blood sugar was too high. Uh-huh. Right, and that's just an excuse. Now, you could have streamed from the hospital. Remember folks that... Irish demon streamed from the hospital. That's right, he did. With broken ribs and a punctured lung. Yeah. I couldn't see, goddammit. Yeah, the heroic Irish demon. Yeah. Yeah. Yeah. Yeah. Yep. And Irish demon, just update those, asking, uh, he has to respond to the Chile lawsuit by next Wednesday. A week from today, the 24th. Nice. So, yeah, we'll see what happens. Um, we are also waiting for the response from, uh, Frauditor Troll in that lawsuit. So, Frauditor Troll versus DMA, or DMA versus Frauditor Troll, as Frauditor Troll was successfully served over the weekend. So, we'll see what happens. But, back to this wonderful girl, as I was saying, this weekend, we are going to try to marry off Parsons 30 times, even if he's not here because he's doing something called Wrestlepalooza. He will have the brides stacking up as we're going for the record of 30. Well, yeah, because you, you, you sent in your, your tribute or you're going to be sending in your tribute because without the tribute, then you don't get access to the vest. I mean, the vest. Let's just go back to this girl. The stripper pool. I thought I got access. How are you doing? I'm doing your booking. Okay. I'm running as good as you can. I have nothing to do with their car accident. I'm going to be honest. My mom pays for my insurance. Yeah. It's all through her. So, I want to get it from her. My phone. Jewel and Diamond said they're willing to work together. Okay. Okay. Speaking of Diamond Jewels, dearly beloved, don't you dare, oh my God, already? We're gathered here today to mend this girl's broken heart because it's your jumper which caused this awful, awful incident. We're here to wrap the fight. At least give us a few minutes to meet her first. That problem. Can he see her naked first? Come on. Nat says to give her a few minutes. Yeah. So, let's give her a couple of minutes. Yeah. Yes. I can't even tell if she's drunk or just slow. Uh, uh, the BAC. Uh, get your, since no one saw the BAC, uh, get your BACs in now. Uh, let's give it a minute before we, we, we have the panel say anything. But yeah, it's a good one. They do give the BAC in this one. Yes, dad. Uh, I did fucking nothing. Sorry. I did nothing to their car. Uh, I was driving home. I live, uh, 39. Right down there. What are you doing? Literally right, right down there. What are you doing? I did nothing to their car. Is she foreign? Why do you think they would be blaming you? Oh, she's just drunk. Because my car did stop. I've had issues with my transmission. Uh-huh. She did your, your issues just transmission. no, it's not, it's not working. It's like she's got a Swedish accent. I can't really point to her. She's just drunk. I'm drunk. Now, now let's go around the panel. You've had your, your chance to see this wonderful woman. Uh, starting with pants. What do you say for BAC? Well, since she's already convinced me she's not a native English speaker, we've got to be up above, like, 0.19. Okay, Phil? I'm going to go with, I'm going to break my usual habit. I'm going to go with 0.315. Wow! Uh, holy cow. Uh, point, point, two, one, two. And finally, NCR. Point, uh, one, three, six. From side chat, we have, let's see, did you do? Sue bear with 0.257. 11 hearts club with 0.169. Gothic Sparrow with 0.245. Lisa with 0.169. Folks, if you know it, don't share it. Uh, but share your guess anyway. Okay, uh, I've had weeks for it. I've had issues with it in front of the past week. And when I start it, it will, like, not move. Yeah. Bad company's in at 0.268. But after, uh, recently, it's been doing it while I'm driving. Yeah. So, uh, Zero's in at 0.169. 1.69. Uh, I'm not surprised, but I did not hit their car or anything. Um, I didn't do nothing. I didn't do nothing. Let's give it a second. Mrs. Tom's in at 0.28. But did she shave her eyebrows? I think she has eyebrows. Those are eyebrows, aren't they? And I see eyebrows. Sure. NCR, you're the master of painting on eyebrows. Those are those eyebrows. Those are eyebrows. Those are not painted on. Why would they be blaming you? Do you have any clue why they'd be blaming you? I went to high school with the girls who had the paint on her eyebrows because she had a genetic condition where she did not have eyebrows. Okay. Complete alopecia? I don't know. I don't remember what it was called. We just thought it was weird because, you know, we were in school. I do. Give me one second. Where are you coming from tonight? Where am I coming from? Yeah. Oh, I went to my mom's house. Oh, okay. He lives over in Batavia. It was a wine tasting followed by a brewery tour. Yeah, you're fine. You're fine. I do have my ID. I'm so sorry. I can get my uh, injury to my mother. I promise. Okay. Yeah, we'll need that. No, obviously. Yeah, obviously. Yeah, obviously. That's my ID. Okay. Alright, if you don't mind, just have a seat on the front of my car for me real quick. No, no problem. No problem. You don't have anything in your pockets, do you? No. Nothing? Okay. You mind to turn your front pockets inside out? You can, your uh, I didn't know if you wanted to start. Your front zipper's down. You can zip it up. No, you're fine. I'm sorry. Notice the little old lady in the background just over here. I wonder what her story is. I'm sorry. No, you're fine. Yeah, just put in. Alright. That's good. Okay. You have a seat right there. She's a citizen journalist, Jim. Respect her rights. She's had it home come to her boyfriend's house. Okay. And she said her car just stopped. She knows zero clue why. And she has no understanding on, well, the reason she thinks why her car stopped is because they're transversed. I know why her car stopped. She has no clue why they're blaming her. Why did her car stop, Phil? RPG. Hit it. Okay. Stopped it. Dead in his tracks. RPG. There is a name we didn't need to resurrect. But still. Leave it. Leave it to the post. I got a list of all kinds of sims. Part of the job description. Hey, tomatoes. While we're at it, please, Mr. Pope Bill, we missed it last night, give the great tribute to Griffey, even though he isn't here because I believe they're out celebrating tonight. Yes, they are out celebrating tonight, and I do know why. Thank you, Sir Griffey, for your ever-presence in our chats and in our hearts and in our minds and your tremendous wisdom that Yorkies are not real domes. Please enjoy the taco that you're eating. I know that you love it so much and it's delicious because you told me. Amen. Okay, then. I'm not going to linger. Do you care if I turn your car off so it don't, like, overheat or anything? Yeah, thank you. I was going to be like, I'm so sorry. Do you like it? Thank you. Hello, how are you doing? Um, doing as well as someone can be in this situation. Yeah, what happened? Couldn't tell you. Couldn't tell me? Well, uh, I've been having transmission issues and, uh, uh, she, she's been not starting, well, she starts but she doesn't go. Okay. And, uh, this happened here and I don't know, like, she doesn't go. what happened with the truck. She starts but she doesn't go. Transmission. Transmission. Transmission. Transmission. Transmission. Yeah. That's not, I know, I know, I know women like that. They start but they don't go. I get it. And it's not Mick Jagger because you can't start her up. That's right. Okay, well, obviously, obviously, your car hit their truck, so. All right. So, uh, how much have you had to drink tonight? Nothing. Any alcohol? No? Do you have any medical problems at all? Um, I do have migraines. Okay. Like the, you know, um, but that has nothing to get me, so I'm okay. Okay. All right. Do you have any problems with your kids, legs, knees, anything like that? Okay. What about your eyes? You wear glasses? I do. You do? I don't have them tonight. I am not even five blocks away from home. Or are you able, do you have to have them all the time? I do need them. uh, my left eye is completely blind and I should have them tonight and I'm sorry for that. Okay. Wait, her left eye is completely blind and she's not driving with her corrective glasses. So there's no depth perception. but, but she's sorry, Jim. She's very sorry. So if she closes the right eye, she can't see what Parson looks like. True. True. Or how far away he is. Yes. Yes. Yeah. Dearly beloved. Dearly beloved, we're gathered here today again. I thought we were marrying off this broken hearted woman to NCR who broke her heart in the first place, but apparently we're getting her to Parson to mend her broken heart because NCR is such a bastard and he dumped her. I never met this woman in a day of my life. You never met her in a dumpster, I know. Parson, do you take this lovely woman who's been broken hearted by NCR to be your lovely wedding YouTube spouse until midnight? Anyone? Anyone? Uh, sure. Anyone? Sure. And broken hearted woman, do you promise to get revenge on NCR for breaking your heart with Parson in the most violent, disgusting ways? Oh, yes. Oh, definitely. Oh. By the power vested in me by NCR's mother to get him out of the house and now pronounce you. You two, husband and wife, you may just die. Well, P, I just choked on my wine. I just choked on my wine. Okay. I am just sober to be here today. It's confirmed. Gia has a drinking problem. That's right. I'm not drinking enough to be here today, apparently. I have no problem with drinking. I don't. You can tell the holy was unhappy with us because I went over to light the candle because the skunk has been spraying out front apparently and I broke five matches in a row before one would light. So, to the unholy, you're welcome. That's thing. I mean, we're only four minutes into the 37-minute video. I am not doing 37 minutes. Yeah, so I will say that. Well, what I want to do is put you through some tests to see if you're okay to drive. Okay? I do look down the block. That's fine, but I still need to run you through some of these tests. You mind doing any of those? Okay. All right. First, I want you to do something for me. You know your ABCs? I'm sorry. I'm sorry. Yeah? Okay. How far did you get in school? High school? College? About the letter R or maybe S? Okay, I'm just asking. So, like, do I have practice today, Godfather? All right. I'm just asking because some people have never graduated. Some people have gone on to college. Okay? It started 8 a.m. Can you say your ABCs if I... Yeah. Okay. If I had you say your ABCs in the letter C... I repeated kindergarten. She seems great. Can you do that for me? All right. Okay, go ahead. C, D, L, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S, T, T, T, T, U, T, U, V, X, Y, You know what? I don't know. Honestly. That's good. You guys don't know? What if I graduated? Which... Well, I ask everybody. No, no, no. I ask everybody because I want to see what your... No, no. Okay. All right. Let's go ahead and go up here. We're going to do a few tests real quick. No, no, no. You have any problem doing those? No. No, I can walk home. All right. Can I walk home? Like, am I being arrested? Wait, no. Am I being arrested? Am I being arrested? Are you sitting with cuffs right now? No. No. Okay. Then I can walk home. No, you can't walk home. You, you, you, you. He moves through the phases of grief really fast. I look at your eyes and I watch the way. No, no, no. You saw. He tried to make me feel like it's f***ing off. So, so are you going to do the test for me? You have to remember, Pant. She's going through a rough breakup at Ben's yard. I don't want to do this. Okay. Put your hands behind your back. Well, apparently I'm just a heartbreaker. I don't know why. Dude, I'll do... I'll do... No, I already, I already offered the test to you and you refused to do it. Please, please, please. Please. Don't pull away. My car. Please. My car. She's squirly. Yes, she is. That's why we married her off. Please. Oh, hello. What's... Please. I just asked you to do the test. I will do the most. I will do. I swear to God. No. I don't... I don't need any more than what I've got already. Please. Please. Please. Do you have anything in your pockets? No. No? No? Okay. I need my keys. I don't think they are. We'll get everything. Everything will stay with the car. You want to do the test or you're going to need to get your car? I swear, I'll do the test. I'll do the test. I'll do the test. I'll do everything. I'll f***ing do anything. I'm... I'm not kidding. I... I get it. Alright. Come in here. Have a seat. Hold on. Uh... Read what banner, hon? What banner am I supposed to read? I don't... Banner under the video? The video. There's no banner. Last or lost? Okay. Uh, hold on. Oh, problem still isn't solved yet? Is that what you're talking about? I don't know. Because your banner says that your starlink is still down. Oh, okay. Oh. See, this is what throws us off. It's little things like this. Yep. Yep. Yeah. Yeah. This is what throws us off. Yep. Yep. Yep. Yep. Yep. And then you blame us. And then you blame us. Yep. Yep. See how he's blaming Rose now? Well, no. The banner says Chiliville Marathon has been rescheduled until September 20th. Jim will go from 8 a.m. to blah, blah, blah, blah. If you'd like to help and continue to make up for the lost revenue with Jim out for the past week, please hit the donation links in the description. Every donation helps and problems do. Oh, so. Oh, and RCN is in the green room. He is. How'd he get? I don't know. Wait. No, wait. How is RCN in? Oh, really cool. Sorry. Really cool. Oh, I'm sorry. I just read it. I read it. Wait. Sorry. RCN. Sorry. Sorry. Five minutes, hon. I just read it. That's all. Yeah, well, see, on this, we don't see it, Rose. So unless I put my mouse over. Yeah, we don't see who's on panel. Oh, now you see me, huh? No, I don't see you. Oh, really? See, there you go. Now I see you. There you are. There you are. How's everyone doing? Okay, so it's supposed to be last. There she is. See, she... Miss America. See, it says... That's... You're singing. That's that. Who was singing? I don't know. I have no idea. See, it says, and Rose is wonderful at the end. Ah, so you fixed it. Very good for you. I had no idea what you were talking about. Remember, I was so sick this afternoon. I was dreaming I was talking to a talking duck for the afternoon. Yeah, yeah. My mom says that was the Purple Mountain. Yes. Yeah, and I'm fighting. I'm fighting that duck. I'll have some of what Jim's having. That duck infused my character in your dream. The duck said something about a chainsaw. Yeah, we are fighting. All I know is the duck was supposed to wake me up at 4.30, and it didn't. So... Because I was up at 4.15. It was supposed to let me sleep. And yes, your hair looks miraculous. It looks wonderful. Miss Dire Hair Red. Never better. Very much. Never better. Yes. Now, I will have to say, though, Jim, I am surprised you are dating a redhead on the East Coast. I'm just leaving it there. That's... I used to keep it this color. I like it. I like it a lot. Well, is... Keep it this color. You're a pretty girl. You can wear any color. Yep. Is Miami technically the East Coast, or is it its own thing now? Well, you know, I'm from... I don't know what Miami is. I'm from Key West, so technically, it is actually Northeast. Oh, there you go. I'm dating a redhead from the Northeast. Oh, dear God. Remember... That can't long enough. I have a friend who lives in Jacksonville, and she, for her whole life, has been... Or since I've known her 25 years, and she's told me she's the Southerner, and I'm like, well, I was born in New Orleans, which is technically far south of Jacksonville, so I'm more of a Southerner than you are. So, even though I was only in New Orleans for like two days, and then we left, so... I was born in Dallas, Texas, and raised in Texas for 13 months. There you go. That explains a lot. The rest of my family lives up in the country. I'm stuck down here in Miami. Yes. So, we are going back to Drunk Girl, because we only have a half hour left on it, so... Ah, good Lord. Let's see what this does. Wait, hold on, I gotta switch rows to... That's not gonna last that long. Let's switch rows and NCR. How about that? There. So, if we go to this... Wait, no, that didn't work. Let's switch me and NCR, and then go to... that. much better. Hey! That worked. Hi, fans. How you two doing today? That worked. Much better. There we go. So, remember, this girl is very drunk, and I am very sedated, and... I'm not sedated. Stop hearing that word. I don't know how she is. Get your super chats in now. Sedated is just the euphemism for high-end cops. Yes. I don't know why he uses that word. Yes. That would... Because I only know three words. So, the last thing we heard her say is, I'm 19! Seven-Rubber, 27. One female for AVI. 21. NCR, what the hell are you doing? You're flashing green. Get your little Miranda card. Freaking lost the other one. I think I lost one. I might have another one in my bag. Mine got... All my stuff got... There you go. There you go. It's up to you. I mean... Yeah. I can do it. I don't need the test. I can smell the odor. I'm going on. Yeah, I figured it out. My scheme... She missed the W. Was playing in the back. I got it shirt off now. She wants to do them. But she refused, so... I'll take care of the braks if you just want to do the tests and stuff. Yeah, that's fine. What were you playing, NCR? Uh... Master Duel. I got Outlast Tiles, and I'm afraid. Oh, I've got a... Daddy Simulator 2024. That's right. I've got to get the monthly off of Humble Bundle to send you new game. No. No, I... I set up a Twitch. The Hey, Nick Doc. Oh, God. I haven't stopped myself from playing all of them. Is that the Doc game? I love you on Steam Deck, and dear God, don't leave me alone with that. Yeah, I gave her a game that she's addicted to. It's terrible. It reminds me of Farmville. Go ahead, NCR. I set up a Twitch so I can try to expand the network that is the NCR News Network. So I'm going to be doing some work over there. Violet? No, it's a Carthic... Gothic Sparrow. I took Robitussin DM before the show because I skipped my afternoon meds for some reason. Probably because I was asleep and talking to a duck. So... Yeah. If you're not talking to invisible people or animals, then you're not on enough cold medicine. Hey, it wasn't... And it wasn't like Howard the Duck. It was just a duck. A regular old duck that was talking. Oh, my God. You're not supposed to talk to quackers. I'm sorry. It was the Aflac duck. The feed and crackers. Aflac. Aflac. It's really a marketing, by the way. Really a marketing. Yep. Before I ask you any questions, you must understand you have the right to remain silent. Anything you say can be used against you in court. You have the right to talk to your lawyer for advice before we ask you any questions and have a lawyer with you during questioning. If you cannot afford a lawyer, one will be appointed for you before any questioning if you wish. You understand these rights. Yes. Are you willing to answer some questions? Yes. How much have you had to drink tonight? And don't tell me nothing because I can smell it. I know. I've had... Abby, we're not dressing up as far as I know. No. No. I may do a horror game series. No. No. No. I am scary enough. The panel is free to dress how they want to dress. So... I know how I'm dressing. Naked! Oh, boy. Yeah. The last time I dressed up on camera has been haunting us all for two years. It was fun. Yeah. Yeah. I was supposed to do all sorts of wonderful things. Yes. Don't worry about that. Yes. And the secret life of Jim Finch out there by some idiot has... has... lives on forever, I guess. All I know is that was the weird part of being offline. I didn't miss the idiots. You know? They didn't impact my life at all. And... It's like... Yeah, I missed you guys. But I didn't miss these people who think they have so much power over my actual life. Oh. So... That's... We love you, Jim. We love you, Jim. We love you, Jim. We love you guys, too. We do a series of horror games. And... And Rose has games coming because I do Humble Bundle and I give her half my games every month. So... Because you get like eight games and I end up giving her and Dexter four of them. So... We'll see what she gets as well. We just got teared down and I got outlasted. Three shots. I'm sorry. Three shots of what? It's Malibu. It's rum. Malibu rum. Okay. What about the shot things that's in the floorboard of your car? That is Pink Whitney and that was not from me tonight. I know I shouldn't have in my car regardless. Halloween weekend was recently. Okay. But I am telling you the truth. Okay. And I swear, I swear, I swear, I... It wasn't from tonight. You should have seen me last week. I was plastered. Yep. And Syria... Didn't she say she's 19? Yes, she did. Yes. She's 19. So it's what? Zero, zero for Ohio? It's a point oh four. She's just admitted to committing a crime. Oh, okay. Point oh four for Ohio. And Syria, I am not on any of the discords with those people. So... Yeah. I don't share that in my life. So I can eat crackers and peanut butter. Yep. Yep. Eat up butter and crackers. Now I'm hungry. I just want to get home. I think we have five houses down. But the thing is, you cause an accident and you're under the influence, okay? You could barely walk when we had you there. You're slurring your words. You didn't complete that first test that I gave you, okay? And then you try to walk away after I wanted you to do these other three tests, but you failed to do that. You wouldn't do it. You started to walk home. I do understand. Okay, so what we're gonna do, you're under arrest right now for operating a motor vehicle under the influence of alcohol. I'm going to jail. We're going down to the jail just to give you a test. Now, who do you live with? My grandma. She lives right down the street. Okay, can she come get you afterwards? Um, I doubt it. Cause I have to have somebody come pick you up. Is there any way I could try to call my mom? We can do that once we get down there and run this test. Okay? And once we get down there... And I have to see our license or anything? Well, there's a factor to that. Okay? So listen. Hold on. Relax. Look at me. She doesn't know the consequences of this. Alexis, look at me. Unbelievable. Let me explain this. Okay? Just, it's... It's a simple rule that I have to read you. I understand. A certain... No, I understand. Okay, hold on. Hold on. Relax. What I need to read to you is a document when we get down there for the test. One, there's two parts to it. You take the test and you're found to have more than what you're supposed to have in your breath, then it's only a 90-day suspension. Three months. But, during that time period, you can petition a court to get driving privileges for work, for school, for doctor's appointments, going to the grocery store, stuff like that. Okay, we're going to jump a little as she's crying. Joy, righty. Could be on your back. I should have been hinted at the 4th. Could be an issue. But my dad's known it, so... Little steps here. I don't... I don't buy that for a second. She's been... in a cup of board. 8, 9, 3, 4, check it out. Are you going to go in? No, we're going to go in. Oh, my God. Like, she's been... I'm trying to make him on my face. Yeah, sleeping. In a big bag. Big bag. Big bag. Big bag. When I come in here, I'll take those handcuffs off you. Once I do that, keep your hands away from your mouth. Okay? Okay. What is it about the mouth? Because we're going to have you blow into this machine. Alright. Okay. Oops, you alright? No, I'm sorry. Are you alright? I'm sorry. Yeah, I'm up at the desk. I thought I was the one called the blowing machine. Can I just make an example? Ouch! Get your hands away from your mouth, please. No, but... It fell off. It fell off? It fell off? It fell off? It fell off your hands. It fell off your hands. I see. It fell off your hands. Can I just say how much to do this test? Or do you know what? We're still going to do it because... But I can't even be honest, right? That helped you with your license. Okay? Alright, yeah. I'm going to tell you I'm going to have this. Alright. I'm going to have this. I only drive really bad back in my life. I always say I'm not 21, so I'm going to fill it no matter what. But, uh... Anyway. Okay, so he's going to read that right there. Alright? So this section right here. You need to read to... No. It feels... It's supposed to fill it right in. Alright. Sit up, please. Alright. You are now under arrest for operating a motor vehicle under the influence of alcohol, drug, or a combination of them. If you refuse to take any chemical tests required by law, your Ohio driving privileges will be suspended immediately and you'll have to pay a fee to have those privileges reinstated. So, like I told you, the length of suspension is based off whether you take this test or not. Okay? Okay, so... When I take this test, if I fill it, am I losing my license? Well, let me explain to you. Length of suspension. Look at this. Look here. For refusal, based on prior refusals, convictions, and guilty pleas within 10 years. You don't have any OVI's, alright? So, if no priors, if you refuse the test, it's a one-year license suspension. But look at this. Look at this. For prohibited concentration of alcohol, so if you test over, based on prior convictions within the last 10 years, which you don't have, no priors, look at this, 90 days. Good night, thank you for stopping by. So, 90 days or one year? Well, that's the craziest part about this. All the craziest. I'm sorry, I'm not. You're great. I love police. Oh, you guys. You're amazing. My mom, my mom, who I tried to call, has an OVI, her husband, not her, not her. Go my mom. Love her. He has an OVI, and his is even not long, and he has a license, so I'm just, I'm funny and saying, the one time I f***ed up, I'm gonna do this. I think this is the Malibu rum talking and not her. Yep. Serial, I don't even know what. It wasn't even a mom. He does have an OVI, he had to go to the classes, and his license was taken. It was 90 days. So this is the other thing. Within a certain period of time, usually 14, 15 days down the road, look at me. Look at me. I'm trying to explain this. I know. You can get driving privileges to work, to school, to grocery store, doctor's offices. But she's being awful. You have to request that. Yes. And the judge may or may not grant that, but generally, I see them grant that all the time. Okay? All right. So you're gonna go ahead and stand up for me. You have a nice seal around this mouthpiece. Don't feel the past this lip. You're gonna take a deep breath. Don't touch it. Sorry. You're gonna take a deep breath. You're gonna blow for the punch in the thing, 15 seconds. You're gonna make a tone. If there's a break in that tone, I'm gonna do three-mouth. I'm gonna try again. Are you here? Yep, blow. Yep, blow. All right. So you have to blow harder than that? Harder? Okay, I'm sorry. Just a nice, consistent breath. Never done. It's all right. Keep going. Keep going. Keep going. Keep going. Keep going. Keep going. Keep going. All right. Don't suck back in. You're gonna blow out. So just take a nice breath. Take a real deep breath. Don't suck back in. I'm going to go. Steady. Keep going. Keep going. Keep going. Keep going. I'm so sorry. I'm going to have to do four. You're fine. It's going to end up having to ask you to do one more. What we do is we take the lower number. So we don't go with a high number, you know, if there's a difference. We go with the lowest number. I'm going to do one more. Alright. My dad, the one that I told you was, you know. Yeah, exactly. I'll go with the high number. Round up. Round up. It may help. Are we good? Yeah. Yep. Best I can do. He's awful happy all of a sudden. I drink box wine and no hard liquor. Just so Gothic knows. There you go. See, that's what they accuse me of. I, you know what? You don't defend shit that isn't true. Yep. Right. Yep. Okay. Okay. Okay. Okay. Hold on. It's alright. Have a seat. So the O2. And because it's, uh, like. So far apart. So. Because we're second level is a lot better. All right, we're going to try this again. Okay. I'll send them. Okay. Hold on. That's all right. Have a seat. So the O2. Oh, so the difference is too. And because it's like. So far apart. So. Because our second load is a lot better. Yeah, but it was really hard, hard boil. Let me talk to my sergeant. Okay. What happened? It printed out two different things. The numbers were really wide apart. So just to make sure that they're not. Yeah, I, yeah. It's going to want you to do another test. Of course. But make sure that the breath is a little bit better. Just slow and steady. So it's like not as hard? Not so hard. Just slow and steady. Slow and steady. Just like you're blowing through a straw. Just slow and steady. Slow and steady. Slow and steady. She blows too hard. Wow. Wow. Well, at least it's not like the girl on It's Always Sunny from the other week who chews. Who chews. That's. I don't know. And you may not be aware of this, Gia, but if you blow too hard, it does hurt. Really? Yes. Wow. And you can hurt the machine if you chew. Wow. Chew. I was so scared. Nice to learn this mouthpiece. I'm going to count down from 10 and just have a nice consistent breath. Thanks so much. You got to put your mouth on it and blow. And blow it into it. I can't be a good, good, good, good, good. Let me try. It's going to make a tone when you're actually blowing into it. Blow into it. Yes. I'm sorry because you're like in some flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow flow Take a deep breath, Han. Ten, nine, eight... Hard to, I still got fever stuck in my teeth. Five, four, three, two... Is that two? Well, that might. It might. If not, oh my god, I'm so sorry, God. Oh, you're fine. I'm trying. What kind? I've never done this before. I don't know whether to be this point or not. You have to do it again? I can't. Alright, alright. I'll try to do it. The way you boarded the last time. But better. The same. The same as the last time. Deep breath. Three, nine, eight, seven, six... Deep breath, deep breath. Keep going. She was falling backwards. Okay, guys, she drunk. I'm too hard on that one. We'll see if it'll take it. That wasn't the same breath as last time. Yeah. I am not. Nice and fresh. Nice and easy flow. So how drunk are you when you're too drunk to do the breath test? Just ask. Oh my god. There's been some of them that have just, are unbelievable. They can't even get their mouth around it. They're so blitzed. Oh, this is number four for this girl. Yeah. Just crazy. Do you always deal with this regularly? Do you have this problem ever? Yes. How should someone hate their life that much? They love from the city, Johnny. Yeah. Her boyfriend will cheat on her. They hate their life that much. They have to be constantly drunk. The drama hands. Well, it says she crashed her car after learning her boyfriend cheated. Yep. So that's why she's drunk. Allegedly. Yep. If NCR cheated on you, you would be so upset. So upset. That was a terrible divorce. I still didn't drink. That's right. Yeah. But it wasn't NCR who broke up with you. And she's allergic to alcohol. Me too. So she wasn't going to. Why am I getting thrown under the bus here? Always. I've been behaving. You have. Because it's not in my programming to cheat. I mean, I haven't been swimming on air. I haven't been throwing muffins at Gia. I haven't been sending the raccoons back to gyms. Yep. Yep. Haven't been blowing up Phil's barbecue. Yeah. Yeah. I don't know. You've been a good boy. Which may take place on Saturday during our marathon. That's right, folks. We may be blowing up Phil on Saturday. Well, I'm checking all of the gas. Perhaps a different choice of words considering what the chat's been putting. Also, we may see his wife's melons in the backyard. His wife's melons. Phil, I have a different terminology. I've been reading the chat. My wife's melons are like Gia's eggs. Dead. Dead. Dead. Dead. You killed her melons? They're dead. Yep. They need water. Wouldn't you know? Yes, you're supposed to water melons. I'm not touching her. I see. Please let people. Okay, we're gonna jump forward. Yes, please. Because she is definitely boring. I'll give you your phone back and you can start making some calls. Here you go. Thanks so much. Same one, same one. Here you go. Damn. Damn. Thank you guys. There has got to be something that's going to happen here because this is taking to his arm. Alright. Here, I'm gonna hold onto your shirt. I'm sorry. We're going out here. This way. I'm going out the door. Yep. I'm sorry. We've received 100 messages from the screen. I'm really sorry. Bring it back over here and then just have a seat in there and I'll get your phone for you. Let's start making some calls. Um, God bless if they don't wake up, you'll have to sleep in a cell. Be honest. No. You promise? We're gonna get something done for you to get in. You won't let me sleep in a cell? Do you want to? No, I don't. Do you want to? Well, let me get your phone for you. Alright. 19 year old, she blew 257. Uh, almost found a legal limit for a 19 year old. Wow! 257. So, uh, she can't get ahold of her mom who probably won't come get her who's a nurse. Grandma lives there five houses down apparently from where we were going, or she was going. Um, uh, let's see. What's your grandma's name? Wendy. Where does she work? Uh, she does, uh, Wendy's. What's it called? Um, where you take the DNA for children stuff. Oh, okay. She works for the government now. Uh, first offense. But, uh, .257. Wow. Yeah, we would have to take her up there. Wow. To the hospital. I mean, it's up to you on taking her home to her grandma. At 19, damn. But, uh, okay. Well, I can't get ahold of her. Um, she's not answering, but she wakes up at like 6 o'clock in the morning to go to work. Um, so it's 442 a.m. and they could wait an hour. And if not, I'll have to, I guess, go up to the hospital with her and have them look at her. What's the idea? You're scared of her. You're scared of her. You're scared of her. You're scared of her. You're scared of her. You're scared of her. You're scared of her. I mean, it's up to you on taking her home to her grandma. At 19, damn. Well, I can't get ahold of her. Um, she's not answering, but she wakes up at like 6 o'clock in the morning to go to work. Um. So it's 442 a.m. They could wait an hour. If not, I'll have to, I guess, go up to the hospital with her and have them look at her. What's the idea? So. Okay. Yeah. 257. So, I, well, she, she started to walk away. She got upset because I asked her, you know, if she graduated. And she got pissed off. And my thing was I wanted her to tell me ABCs from the letter C to the letter W. And then she started and she missed W. And then she started to walk away. She missed a lot. And I said, no, you're not going home. Not just W. We're going to do these tests. And she goes, no, I'm going home. So I just went in and arrested her. I had, I had enough just with way she was act, acting, talking, walking. So. Okay. All right. Sounds good. See ya. Bye. I'm going to take you to your grandma's. I'm going to knock on her door real quick and then get you out of here. We're mad with us. Hey, Nick. Too late. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. Hey, Nick. okay so she was going down the street down here had an accident yeah she's okay she says she's okay she's highly intoxicated so yeah we already did we already sided her with that just because she totaled her car and somebody else's car yeah so I'm gonna she left here it was late she was fighting with somebody their boyfriend yeah all right just gonna put some shoes on all all like I said she you know we wanted to bring it here instead of the jail but but I don't think you know mentally she's she's upset like really bad so okay all right oh great yeah grandma needs that yeah yeah I think I think mommy's a drunk too grandma's a water when grandma's say that you're that's yeah yeah yeah we've got a couple minutes left in this remember uh Saturday we're doing the all-day marathon if you want to donate please donate as we've been off the air and YouTube sanctions are killing us or whatever is going on and I haven't been reading private chat all night so oh eight more super chats and I'm suing Jim yeah yeah see more super chats honey I'm not splashing people I'm bringing your message I'm not splashing people come on now all right all right right there all right no she's relieved that you're okay she is relieved that you're okay don't lie to me you're gonna be well he's just gonna have to make sure that you don't do anything like this again well no mistakes happen but like I said mistakes happen and that let's go up here and all all explain this to you real quick where we don't want her to meet in your side of the bus remember that form that I read to you at the sheriff's office no someone that's your purpose you know that the former at the up there and had you sign so this is a copy of it okay that basically is an ALS suspension so your license is suspended right now I explained to her so basically she's gonna go to court Monday at 8 30 so you're gonna go up there and show you please I can take you because I'm off work or not Monday Tuesday sorry Monday is a holiday isn't it yeah so this is the thing so you go up to court and it's gonna be like an arraignment guilty not guilty no contest whatever right no matter what you plead license is suspended in 90 days however I told you within 14 days you need to submit to the court and say hey I need driving privileges to work one of the doctors office school whatever I'm lost my job I was supposed to be there today yeah I was supposed to be there for you and it's gone here were you fighting okay let's see what I'm talking about it actually yeah okay um my dog is gone so um so like I said we figured out your life ain't over you're only 20. right trust me that feels over it really feels over remember the conversation you had the other day this is when drinking causes you a problem you'll get over it you can't drink and drive you'll get over it you will so the 12th you have court at 8 30 Claremont music court the address is right up here you know where it's at what happened um she was cited for OVI and also what's the night you struck it struck another car everyone keeps telling me hi there's uh the other rose came in Rosetto you're not the only rose yes she's making sure yeah she's paying I hear two OVI sections on here one uh being since she's underage under 21 that only goes point oh two point oh eight she blew 12 times illegal limit so she was like point two five seven so you're you're you're up there a little bit so these are her test sheets the first one um since it was uh since the thing basically she she blew too hard in the in the first one it scores it differently and says we're not gonna we're not gonna take that as a test and those are pretty high tests and then the second one that she did that was her test there so these copies are evidence copies for her as well as her citation as well as that form that she has there I have her driver's license and I'm only explaining it to her because when you wake up then you'd be like where's my license oh my god I'm gonna myself no you're not she does get yeah yeah I know she does so do we need to take you to the hospital now do not do not if you do it if you do it now I'll really end it faster I swear to god Lexi stop you don't even realize what you're saying no I didn't realize for you this you're only 20 you don't you're yeah it's take her to the hospital she's really suicidal I gotta go collect DNA down the state of Kentucky for a half a day she's not going to be back so I'm worried about leaving her now with that statement call 911 right now she makes it all the time that's why she's here and not at her mom I know but when she makes that in front of us it kind of puts us in a pickle so I know there's a problem they gotta do something all I'm trying to do is help her to give her a place to live is there any weapons in her house? you're not going to help her grandma firearms they're all locked up they're in my husband's house does she have any access to them? no where's your husband at? is he at work? yeah he just left work 15 minutes a day so the thing is we don't have anybody that's going to keep an eye on her today she'll be alright she'll slip it off she won't she'll slip it off this ain't the first time but I when she left here she was arguing with him last night and I should have stopped her because I seen her going out the door it was like 1130 she said I'll be back and I could hear her arguing with somebody upstairs and even her mom stopped by her yesterday and she goes why is she sleeping? I said I don't know she was out all night last night so she's two days meeting anyone near 2-5 for a 21 transfer uh she was charged with underage driving under the influence driving with a prohibited breath alcohol concentration operating a vehicle without reasonable control what was that hon? how old was she? she's 19 19 she looked in her mid 20s on January 7th, 2025 she pleaded guilty to an amended charge of reckless operation all the original charges were dismissed she was fined $200 plus court costs ordered to attend a 3 day drivers intervention program and her license was restricted for one year she was also placed on probation for one year and ordered to complete 24 hours of community service and that folks looks to be the end of our show tonight I want to thank everybody Pants, Rose, our crew there's Rose, hey babe I am a slice of bread see I am a slice of bread you are a slice of bread there you go this is a bread blanket I am a slice of bread nice well folks anything from our crew? any last words before we get out of here? yeah now I'm tired longer yeah long day long day long day long day remember putting your book face down on a table is equivalently using the entire world as a bookmarker there you go that's a good point I've been watching the anime, right? right in the world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world in world Good night everybody. Thanks for tuning in. We hope you enjoyed the show. If you learned anything, it was purely on accident.